Hearing is a complex process, so it should be no surprise that the causes of hearing loss are also complex. Hearing loss can occur because of damage to the ear, especially the inner ear. For example, infants may be born with hearing loss caused by a viral infection that was acquired during pregnancy. Other times the cause is genetic and therefore due to changes in the genes involved in the hearing process. Sometimes, hearing loss is due to a combination of genetic and environmental factors. There is, for example, a genetic change that makes some people more likely to develop hearing loss after taking certain antibiotic medications.
Understanding the genetic causes of deafness has important benefits. This knowledge not only allows doctors to inform families about their chances of having children with hearing loss, but it can also influence the way a person's deafness is treated. Whether a person's hearing loss is going to worsen can sometimes be predicted if the specific cause is known. Also, deafness may be only one of a group of medical problems that a person may have. For example, some people with hearing loss also have problems that affect other parts of the body, such as the heart, kidneys, or eyes. Knowing the genetic cause in these cases allows a doctor to predict the appearance of these other problems.
It might seem reasonable to suspect a genetic cause of deafness only if the hearing loss runs in the family. But there are situations in which children have genetic deafness even though neither one of their parents are affected. This deafness can also be passed on to future generations. Genetic tests can therefore be helpful even if there is only one person in the family with hearing loss.
The genetics of hearing loss can be complicated and difficult to understand. This brochure is designed to help explain the role of genetics in hearing loss, how genetic testing is done, what the results of genetic tests mean, and what options are available for treatment and counseling. If any of this information is unclear, please feel free to ask questions of your or your child's physician, or request to speak with a genetic counselor.
How is Hearing Loss Detected and Diagnosed?
It is important to detect hearing loss as early as possible so that a child can develop appropriate communication and learning skills. For this reason, many states now give a simple, painless hearing test to all newborn children to determine if the child can hear sound. Without this newborn screening, hearing losses might not be noticed by parents or doctors until the child begins to have difficulties speaking and learning-sometimes as late as age 2 or 3. Therefore, it is important to have this test done at a very early age. Children who do not pass this test are then seen by an audiologist for more tests.
An audiologist will first determine the severity and type of hearing loss. The severity of hearing loss is measured by observing how loud a sound needs to be for the child to hear it. This is often referred to as the hearing threshold level. The different types of hearing loss are classified according to what part of the hearing system is affected. Sound is picked up by the outer ear and then passes through the ear canal to the middle ear. Problems in these places cause conductive hearing loss. After passing through the middle ear, the sound then travels to a part of the inner ear called the cochlea, where it is changed to a signal that can be sent to the brain. Problems here cause sensorineural hearing loss.
Anatomy of the Ear
Next, an effort is made to find the cause of the hearing loss. Some kinds of hearing loss occur when the hearing system is damaged by things like loud noise, head injury, medications, or infections. Sometimes, knowledge of these causes can help to treat the hearing loss or stop it from getting worse.
Another possibility is that the hearing loss is genetic. This means that it is carried down through a family. This is why recording a detailed family history is very important. There are two main forms of genetic deafness: syndromic, in which there can be other medical problems in addition to the hearing loss, and nonsyndromic, where the only obvious medical problem is the loss of hearing. Although most hereditary hearing loss is nonsyndromic, there are also many syndromes that have deafness as a feature. A list of common deafness syndromes is given in the following table. Identification of these syndromes is particularly important in helping to predict whether other medical problems might occur. Deciding whether a hearing loss is syndromic or nonsyndromic is not always easy because some problems can be subtle or only detected by special tests. For example, a special eye exam is required to diagnose Usher syndrome and an electrocardiogram is needed to identify Jervell and Lange-Nielsen syndrome (see table). As a result, a doctor may ask for the help of other specialists such as a cardiologist, ophthalmologist, or clinical geneticist.
| Common Forms of Syndromic Deafness | ||||||||||||||||||
|
Although a family history can help find a genetic cause, the absence of a family history of deafness does not mean that the deafness is not genetic. In fact, genetic deafness may appear for the first time in a child whose parents are not deaf and may not have any family history of deafness. It is, therefore, important to combine information from physical exams, clinical tests, a family history, and genetic tests to identify the cause of hearing loss. This can help in the treatment and management of the deafness, and to predict the possibility of passing on the deafness to future generations.
How is Hearing Loss Inherited?
It is estimated that about half of all childhood deafness is due to hereditary causes. These hereditary causes involve genes in the hearing process that are inherited or passed down in a family. All of the genes in our bodies are made of a chemical called DNA (deoxyribonucleic acid). DNA is a chemical made of four kinds of building blocks, or bases: adenine (A), cytosine (C), guanine (G), and thymidine (T). These bases can be strung together in many different combinations to create unique DNA sequences. Genes are made of these sequences and contain the instructions for life. A small part of a gene might have a DNA sequence that looks like this: ATTCTGATTTAAGCTA. In total, humans have about 100,000 different genes that are grouped into small structures called chromosomes. People have 23 pairs of chromosomes, including a pair of sex chromosomes. Each pair consists of one chromosome that is inherited from the mother and another chromosome that is inherited from the father. The sex chromosomes contain genes that determine the sex of a person. Girls inherit two X chromosomes, whereas boys receive one X chromosome and one Y chromosome. The following figure demonstrates how the chromosomes are passed down from a mother and father to a child.
Chromosome Inheritance
Because people have two versions, or copies, of every chromosome, they therefore have two copies of every gene. The DNA sequences of these genes are more or less the same in everyone. However, sometimes there is a difference in one person's gene sequence as compared to the majority of the population. This DNA change is called an alteration, or mutation. Some mutations may occur that do not interfere with the health of an individual. Other mutations disrupt the gene enough so it does not function correctly. Below is an example of a mutation in a gene associated with hearing. The base change from G to T is enough to alter the instructions contained in the DNA sequence.
 ...AGATGAGCA… |
Normal sequence | = Working gene |
| ...AGATTAGCA... |
Mutated sequence | = Non-working gene |
Gene mutations can be dominant or recessive. If only one altered gene is needed for an individual to be affected, the mutation is considered dominant. For example, if a mother passes on a gene with a dominant mutation, the child will be affected even if the copy received from the father is unaltered. In other words, the altered copy from the mother was "stronger" than the unaltered copy from the father.
A mutation can also be recessive. In this case, the altered gene is not strong enough to have an effect if a person also has one unaltered gene. As a result, an individual must inherit two altered genes, one from each parent, in order to be affected. The term carrier is used to describe a person who has one unaltered gene and one gene with a recessive mutation. This person is not affected but can pass on that mutation to his or her children.
A special situation, called X-linked inheritance, involves recessive mutations in genes on the X chromosome. Women have two X chromosomes, whereas men have one X chromosome and one Y chromosome. Therefore, a son only needs one copy of a recessive gene mutation on the X chromosome to be affected. This is because he does not have a second X chromosome to provide the unaltered version of the gene. For more detailed explanations of these forms of inheritance, see the following three figures.
Inheritance of a Dominant Mutation
Children receive one copy of each chromosome from their mother (shown in green) and one copy from their father (shown in blue). In this example, a red band is used to represent a dominant mutation in a gene on one copy of the father's chromosomes. Because the mother has two copies of the unaltered chromosomes, all her children will receive an unaltered copy from her. In contrast, the children each have a 1 out of 2 (or 50%) chance of receiving the copy with the dominant mutation from their father. As shown in the figure, 50% of the children will inherit a chromosome with the dominant mutation. Remember that, in the case of dominant mutations, just one copy is needed for an individual to be affected. It follows, then, that 50% of the children will be affected.
Inheritance of a Recessive Mutation
Children receive one copy of each chromosome from their mother (shown in green) and one copy from their father (shown in blue). In this example, a red band represents a recessive mutation in a gene on one copy of the father's chromosomes and a second red band represents a recessive mutation in the same gene on one copy of the mother's chromosomes. Each child has a 50% chance of receiving the copy with the recessive mutation from either parent. But, in the case of recessive mutations, both copies need to be altered for an individual to be affected. The chance of two events happening at the same time can be found by multiplying the chance of the two separate events together.
| (chance of receiving mutations from father) |
1/2
|
|
| X
|
(chance of receiving mutations from mother) |
X 1/2
|
| = |
(chance of receiving two mutations) |
1/4
|
Therefore, in each pregnancy, there is a 25% chance that the child will inherit both mutations and, on average, 1 out of 4 children will be deaf.
Inheritance of an X-Linked Recessive Mutation
Children receive one sex chromosome from their mother (shown in green) and one sex chromosome from their father (shown in blue). Because women have two X chromosomes, all children inherit an X chromosome from their mother. On the other hand, males have one X chromosome and one Y chromosome. Therefore, children may receive an X chromosome from their father and become a girl, or receive a Y chromosome and become a boy. In this example, a red band is used to represent a recessive mutation of one of the mother's X chromosomes. As shown in the figure, even if the girls inherit an altered copy from their mother, they will still be unaffected because they will get an unaltered copy from their father. On the other hand, the boys receive a Y chromosome from their father so they do not have an unaltered copy of the X chromosome to block the effect of the mutation. Therefore, because sons have a 1 out of 2, or 50%, chance of inheriting the altered X chromosome from their mother, they have a 50% chance of being deaf.
There are also cases in which a genetic mutation is seen for the first time in a person whose parents do not carry the mutation. This type of mutation is called a spontaneous mutation and is usually caused because of a DNA change in a gene in the parent's sperm or egg cells. This is one way that genetic inheritance of a trait can suddenly begin within a family when ancestors were not affected. In this case it would have been impossible to predict that the child would be affected, but the chance of future generations having deafness can be determined.
An additional form of genetic inheritance observed with hearing loss is called mitochondrial inheritance. Mitochondria are small structures within cells involved in providing energy for the cell. Mitochondria have their own sets of genes, different from the cells genes. If there is a mutation in one of these genes, the mutation can be passed through mitochondrial inheritance. During reproduction, only the egg from the mother, and not the sperm from the father, contributes mitochondria to the developing child. As a result, only females will pass on mitochondrial traits to their children.
Although there are many forms of hearing loss that are caused by mutations in single genes, other types are believed to require mutations in two or more genes in order for a person to be affected. Also, mutations in some genes do not appear to cause hearing loss directly. Instead, they put a person at risk for deafness due to environmental factors, such as exposure to loud noise or antibiotics. The continued study of people with hearing loss is needed to understand these situations and the sometimes complex connections between genetics and hearing loss.
How are genetic mutations detected and how can we use the information learned from this analysis? Genetic testing is the process of comparing the sequence of a particular person's gene with that of the regularly occurring gene. The comparison may detect mutations that could make the gene stop working.
It is important to keep in mind that genetic testing can only be performed if the gene that is altered in a given condition is known. Although the genes that contribute to deafness are being discovered at a rapid pace, there are many forms of hearing loss for which the responsible gene remains unknown. A person can only be tested for those genes that have already been discovered. Furthermore, some genes are very large and difficult to analyze. If such a gene is rarely involved in a disorder, it may not be practical to determine the sequence of a person's entire gene. However, as technology improves and more genes are discovered, many genetic tests will become more widely available.
Mutations in the connexin 26 gene (on chromosome 13) are the most common genetic cause of deafness and are thought to be responsible for up to half of recessive nonsyndromic hearing loss. Consequently, the most common genetic test for deafness is the connexin 26 gene test. Luckily, the gene is very short, which makes the genetic test relatively easy. As a result, any child who is born deaf, or who develops hearing loss at an early age, is a candidate for connexin 26 testing. This is especially true in cases where obvious environmental causes are not found.
Certain connexin 26 mutations are more common within specific populations. One mutation, called "35delG", is often found in Caucasians, where it is estimated that as many as 2-3% of people have at least one altered copy of the gene. This mutation is called 35delG because the G at position 35 of the sequence is deleted. This mutation is shown below.
| 35delG Mutation: The G at position 35 is highlighted in blue. | ||||||
|
||||||
|
Another mutation, referred to as "167delT", is common in the Ashkenazi Jewish population, with almost 1 out of 20 people having at least one altered copy. As before, the 167delT name means that the T at position 167 of the connexin 26 sequence has been deleted. Usually, mutations in the connexin 26 gene are recessive, so that both copies of the connexin 26 gene must have mutations to cause deafness.
People who have mutations in both copies of their gene can often be given accurate and straightforward genetic information. Sometimes, however, the results are more complicated. Some changes in gene sequences have never been seen before and are of unknown significance. Not all sequence changes in the connexin 26 gene cause hearing loss. Moreover, although both copies of the connexin 26 gene must usually be mutated for hearing loss to occur, some people with hearing loss have only one connexin 26 mutation. It may be that there is a change in the other copy of the gene that is difficult to identify and was therefore missed. Alternatively, the mutation may be dominant and one altered copy may be sufficient to cause hearing loss. Also, it is possible that the deafness in such a person is not related to connexin 26 at all. The person may have another mutation in a different deafness gene that is causing the hearing loss. Finally, the deafness may be due to nongenetic causes entirely. These are reasons why interpretation of genetic test results is not always easy.
Many genes contribute to hereditary hearing loss and the list is growing quickly. As new genes are discovered, the number of genetic tests for hearing loss will also increase. Specific genetic tests currently available are described in the information cards included with this brochure.
How is Genetic Testing Helpful?
Knowing the genetic cause of a person's hearing loss can lead to improved decisions about treatment and management. In some cases, genetic information can help predict whether the hearing loss will remain the same or whether it will worsen over time. Knowledge of the genetic cause is also useful in determining what kind of damage has happened to the hearing system to cause the deafness. This is important because how the inner ear is damaged may affect whether a cochlear implant, or other hearing device, may help a patient. In addition, because mutations in some genes cause syndromic hearing loss, genetic testing can help determine if problems besides hearing loss may be present or may develop in the future.
In addition to improved treatment choices, genetic information may help in other ways. Genetic testing can provide a deaf individual or the parents of a deaf child with the satisfaction of understanding the cause of the hearing loss. It can also be useful when making reproductive choices. If the genetic cause of a person's deafness is known, it is then possible to predict the likelihood that future children of that person will also have hearing loss. This may affect a couple's decision to have more children, or it may be used to help them prepare for the birth of a deaf child.
In general, how people use genetic information will vary widely depending upon individual perspectives about hearing loss, religious beliefs, and other factors. Regardless of how the genetic information is used it can be an overwhelming and stressful experience for people to learn that a mutation in their own genes is the cause of their child's deafness. It should be remembered, however, that genetic mutations are very common. All people carry gene mutations that might affect their health or physical characteristics. Mutations in some genes may cause medically important conditions, while others explain many of the normal differences between people. No person is responsible for the particular genes he or she possesses.
These benefits and drawbacks of genetic testing must be understood by anyone considering testing so that an informed decision about testing can be made. Genetic counselors are skilled in educating others about genetic testing and its many associated issues. You should feel free to contact a counselor or doctor if there is any information about genetic testing that is unclear, or if you would like to discuss your particular situation.
audiologist - a person who specializes in evaluating people with hearing loss Click here to return to the passage.
cardiologist - a doctor who specializes in heart diseases Click here to return to the passage.
carrier - a person who has one unaltered version of a gene and one version with a recessive mutation; this person is not affected by the mutation. Click here to return to the passage.
chromosome - a structure containing many genes arranged on a long strand of DNA; each person has 23 pairs of chromosome, including a pair of sex chromosomes. Click here to return to the passage.
clinical geneticist - a doctor who specializes in recognizing and treating patients with genetic diseases Click here to return to the passage.
conductive hearing loss - hearing loss caused by problems in the outer or middle ear Click here to return to the passage.
DNA (deoxyribonucleic acid) - the chemical that makes up genes; it is composed of adenine (A), cytosine (C), guanine (G), and thymidine (T). Click here to return to the passage.
dominant mutation - a mutation in a gene that is strong enough to make a person affected even if the person also has a normal copy of the gene Click here to return to the passage.
electrocardiogram - (ECG or EKG) - an electrical measurement of heart function Click here to return to the passage.
gene - a unique sequence of DNA that serves as a specific set of instructions in the body Click here to return to the passage.
hearing threshold - the lowest level of sound that can be heard during a hearing test Click here to return to the passage.
hereditary - inherited; something that is passed from parent to child Click here to return to the passage.
mitochondria - small structures within cells that provide energy for the cell Click here to return to the passage.
mutation - a change in a gene sequence that often disrupts the function of the gene Click here to return to the passage.
nonsyndromic deafness - hearing loss that occurs in the absence of other medical problems
ophthalmologist - a doctor who specializes in studying eye diseases Click here to return to the passage.
otolaryngologist (ENT/ORL) - a doctor who studies ear, nose and throat disorders
recessive mutation - a mutation in a gene that is not strong enough to make a person affected if the person also has a normal copy of the gene Click here to return to the passage.
sensorineural hearing loss - hearing loss caused by problems in the inner ear Click here to return to the passage.
syndromic deafness - hearing loss that is associated with other medical problems Click here to return to the passage.
X-linked inheritance - a special form of inheritance that involves mutations on the X-chromosome Click here to return to the passage.
08/15/01
…
CTGGGGGTGTGAACAAACAC…